

LOADING CONTROL WESTERN BLOT PRO
Total cell count was calculated using StainFree analysis, and transfection efficiency was measured by dividing the number of GFP-positive cells by the total number of cells using SoftMax Pro Software.įigure 2. Transfected cells expressed GFP and were identified and counted in the green fluorescence channel of the MiniMax cytometer. Afterwards, cells were incubated at 37☌ overnight. 6 µL of FUGENE HD transfection reagent and 2 µg of total DNA (3:1 ratio) were used to transfect cells. In parallel, three wells of cells were transfected with the pCas-Guide-EF1a-GFP vector that transiently expresses GFP as a transfection control. Cells were transfected with (1) a guide vector (AAGATGTGCTTCGAGATGTG) and (2) a donor vector containing sequences for puromycin resistance and GFP. HEK293 cells were seeded in Costar tissue culture-treated 6-well plates at 300,000 cells per well. Trans-Blot® Turbo™ system (Bio-Rad cat.TransBlot Turbo Mini-size LF PVDF membranes (Bio-Rad cat.Pierce BCA Protein Assay Kit (Thermofisher cat.ScanLater: Anti-Mouse Evaluation Kit (Molecular Devices cat.ScanLater: Eu-Streptavidin Evaluation Kit (Molecular Devices cat.SpectraMax® MiniMax™ 300 Imaging Cytometer (Molecular Devices cat.ScanLater™ Western Blot Detection System (Molecular Devices cat.SpectraMax® i3x Multi-Mode Microplate Reader (Molecular Devices cat.pCas-Guide-EF1a-GFP Plasmid (Origene cat.ATG5 HEK293T cell transient overexpression lysate (Origene cat.Rabbit Polyclonal Antibody against ATG5 (Origene cat.Opti-MEM Reduced Serum Media (ThermoFisher cat.FUGENE HD Transfection Reagent (Promega cat.ATG5 Human CRISPR Knockout kit via CRISPR (Origene cat.Knockdown was verified with ScanLater western blot analysis. We used Origene’s ATG5 human gene knockout kit via CRISPR kit to knock down Autophagy Related 5 (ATG5) protein expression in HEK293 cells and knock in green fluorescent protein (GFP) and puromycin resistance genes. Here, we demonstrate how the SpectraMax i3x Multi-Mode Microplate Reader and ScanLater Western Blot Detection System can be used to validate CRISPR/Cas9 genome editing. Usually, genomic PCR and genetic sequencing tests are performed to confirm successful deletions or insertions, however, measuring protein expression is a more definitive measure of gene knockdown, avoiding signal from in-frame deletions/mutations 7. Validation of gene editing is necessary to determine if the introduced mutation knocked down the gene of interest. The Cas9 enzyme then creates a double-strand break, and either the NHEJ or the HDR pathway is used to repair the DNA, resulting in an edited gene sequence. The Cas9 enzyme is activated by first binding to a guide RNA, then binding to the matching genomic sequence that immediately precedes 3-nucleotide PAM sequence. The NHEJ pathway is commonly used to disrupt genes via base insertions or deletions (indels), while the HDR pathway can be used to knock in a reporter gene or an edited sequence by exchanging sequences between two similar or identical molecules of DNA 6.įigure 1. After a double-strand break is made, the cell will undergo one of two repair pathways: the nonhomologous end joining (NHEJ) pathway or the homology-directed recombination (HDR) pathway. By harnessing this system, researchers can study the effects of gene silencing and transcription regulation, and they can potentially alleviate genetic disorders in diseased cells 5.Ī guide RNA (gRNA) similar to a crRNA is designed to target a region in the gene, and the Cas9 enzyme can create doublestrand breaks in this specific region of the host cell’s genome (Figure 1).

Short sequences of known foreign DNA are expressed as CRISPR targeting RNA (crRNA), which guide the Cas9 enzyme to cleave any foreign DNA containing a similar sequence. It originated as part of the innate immune system of bacteria and archaea and was used to protect against foreign DNA 3,4. The CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)/Cas9 system has become a very popular tool for editing genes due to its high accuracy and ease of use 2. Genome editing has been widely used to study gene expression and protein function, but many of these methods are labor intensive and inaccurate 1. High-Content Screening with AgileOptix Technology.PROTEIN DETECTION, QUANTITATION, ANALYSIS.NUCLEIC ACID (DNA/RNA) DETECTION & ANALYSIS.SpectraTest Validation Plates and Recertification.
LOADING CONTROL WESTERN BLOT SOFTWARE
